Des questions: page 17687

0 votes
0 réponses
res.locals ne stocke pas la variable donnée par une fonction de rappel
Tout d'abord, je suis nouveau dans les domaines node et express, je pense donc que je perds quelque chose dans la logique de express.js. J'es...
a demandé il y a 7 mois
0 votes
0 réponses
Utilisation de l'ensemble de données avec les paramètres de BigQuery dans le Cloud Data Prep?
J'ai plusieurs jeux de données BigQuery avec des tableaux créés quotidiennement, tels que pommes_201904010 pommes_201904009 etc. Je...
a demandé il y a 7 mois
0 votes
1 réponses
Ajout de texte et de valeur à ComboBox dans WPF
J'ai suivi le code WinForm suivant ce lien: http://net-informations.com/q/faq/combovalue.html Public Class Form1 Private Sub Form1_Load(By...
a demandé il y a 7 mois
1 votes
2 réponses
Erreur ReactorNotRestartable lorsque je vérifie si le réacteur est déjà en marche
Code: def hook(ui, repo, hooktype, node=None, source=None, **kwargs): from buildbot.clients import sendchange from twisted.internet i...
a demandé il y a 7 mois
0 votes
2 réponses
erreur TS2507: Le type 'typeof Tapable' n'est pas un type de fonction constructeur
J'ai créé une bibliothèque TypeScript privée à utiliser dans quelques autres projets que j'ai. Son but est de contenir des modèles TS partagés....
a demandé il y a 7 mois
1 votes
1 réponses
Récupérer des données de liens inconnus avec le marionnettiste
J'ai plusieurs morceaux de code dans lesquels j'obtiens des données HTML qui n'ont pas une très bonne structure pour récupérer les données, par...
a demandé il y a 7 mois
0 votes
0 réponses
Itérer à travers des objets sans nom [dupliquer]
Je souhaite parcourir les objets contenus dans un tableau et modifier les propriétés de chacun. Si je fais cela: for (var j = 0; j < myArra...
a demandé il y a 7 mois
0 votes
3 réponses
Comment puis-je attraper plusieurs exceptions et boucle jusqu'à ce que je reçoive une entrée valide?
Je dois intercepter 3 exceptions et boucler jusqu'à ce qu'une entrée valide soit entrée. À l’heure actuelle, mon programme se termine lorsque...
a demandé il y a 7 mois
0 votes
1 réponses
Comment créer une table de vente à partir de fichiers JSON à l'aide de Python
J'ai un fichier JSON comme celui-ci et j'ai des problèmes pour générer un tableau avec COLONNES comme Nom, numéro, code pays (premier article da...
a demandé il y a 7 mois
0 votes
1 réponses
Le contrôleur d'entrée multi-plateforme ne fonctionne pas sur le périphérique mobile
J'utilise Unity Standard Assets - Contrôle des entrées sur plusieurs plates-formes pour créer Dpad conformément aux exigences de mon jeu. Je...
a demandé il y a 7 mois
0 votes
0 réponses
Comment exécuter Gnome-Shell dans Travis-CI?
Comment lancez-vous un environnement simple sans tête Gnome-Shell dans Travis-CI ou un système d'intégration continue similaire? J'essaie d'e...
a demandé il y a 7 mois
0 votes
1 réponses
Besoin d'aide pour écrire une requête de mise à jour pour éviter d'utiliser une boucle
J'utilise Microsoft SQL Server 2014. J'ai deux tables. Un pour les numéros de commande (ordres) et un pour les emplacements intermédiaires pour...
a demandé il y a 7 mois
0 votes
0 réponses
Revenus trimestriels des données du panel de capital-investissement
J'essaie de calculer le TRI trimestriel d'un ensemble de données de panel de fonds de capital-investissement avec R. Lorsque je suis un débutant...
a demandé il y a 7 mois
1 votes
2 réponses
Analyser le dataframe
J'ai le cadre de données quelque chose comme ci-dessous au format CSV: Country Status People_eligible_Count XYZ True 100000 XYZ...
a demandé il y a 7 mois
1 votes
0 réponses
La chaîne MCMC converge mais la topologie log-postérieure est incorrecte pour la convergence
J'ai utilisé un modèle bayésien dans STAN pour estimer un modèle de régression d'erreur de mesure. Les diagnostics disent que la chaîne a conver...
a demandé il y a 7 mois
1 votes
1 réponses
Comment obtenir le nombre de séquences dupliquées dans un fichier fasta en utilisant python
J'ai un fichier fasta comme celui-ci: test_fasta.fasta >XXKHH_1 AAAAATTTCTGGGCCCC >YYYXXKHH_1 TTAAAAATTTCTGGGCCCCGGGAAAAAA >TTDTT_11...
a demandé il y a 7 mois
0 votes
0 réponses
lire des fichiers texte dans un fichier zip sans décompresser dans matlab
Je voudrais lire des fichiers texte dans un fichier zip sans décompresser à l'aide de Matlab Lire les données du fichier CSV dans Zip File s...
a demandé il y a 7 mois
0 votes
1 réponses
Requête de connecteur Kafka Connect JDBC + inductions de mode d'incrémentation avec de grands ensembles de données lors de l'interrogation initiale
J'utilise le connecteur JDBC pour transférer des données de MySQL vers Kafka. Les données qui m'intéressent proviennent d'une sélection de 3 tab...
a demandé il y a 7 mois
0 votes
0 réponses
comment parcourir une liste dans une série
J'ai un series qui contient un list à l'intérieur. Chaque 0600350991111101035062 du list a une longueur différente. La raison est que j’avais un...
a demandé il y a 7 mois
0 votes
1 réponses
Impossible d'installer le fournisseur de package Nuget dans Powershell Core 6.2.0
J'ai webjob in azure. J'essaie d'installer le module Az dans le noyau powershell 6.2.0 en utilisant le code suivant: using (PowerShell ps = Po...
a demandé il y a 7 mois
0 votes
0 réponses
Écran noir avant splash si la géolocalisation en arrière-plan est activée
J'utilise backgroundgeolocation dans ionic v3. Sur Android, avec le plug-in activé, lorsque je supprime l'application du menu de navigation et...
a demandé il y a 7 mois
0 votes
0 réponses
Si j'ai 20 copies d'un tableau croisé dynamique sur une feuille de calcul et modifie la source de données, CHAQUE TABLE sera-t-elle mise à jour?
J'ai un classeur avec 20 tableaux croisés dynamiques différents qui se copient l'un l'autre. Ils font tous référence à la même source de données...
a demandé il y a 7 mois
0 votes
0 réponses
Comment utiliser spinnaker Mettre à jour une API de définition de pipeline
J'essaie d'utiliser cette API de définition de pipeline de mise à jour https: //spinnaker-api.svc. k8s.pinadmin.com/swagger-ui.html#!/pipeline4...
a demandé il y a 7 mois
0 votes
2 réponses
Laravel: Les utilisateurs de table n'ont pas de colonne nommée updated_at [duplicate]
     Cette question a déjà une réponse ici:                   modifier le nom du fichier created_at et updated_at de Laravel             ...
0 votes
1 réponses
EF Core plusieurs à plusieurs colonnes non désirées
J'essaie de créer un modèle qui a une relation deux fois, plusieurs à plusieurs.    StockItem * - * QualityCheckDefinition       Article * -...
a demandé il y a 7 mois